|
Servicebio Inc
u6 forward pcr primer U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/primer+snrna+u6/pmc13145395-12-3-8 Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Eurofins
htrac hdr genomic forward primer targeting lha Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/and+forward+oligonucleotides+reverse+sgrna/pmc13265900-94-0-10 Average 86 stars, based on 1 article reviews
htrac hdr genomic forward primer targeting lha - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
pelb forward primer Pelb Forward Primer, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/primer+sequences/pm42321788-80-16-10 Average 86 stars, based on 1 article reviews
pelb forward primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Eurofins
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha Gse310442 Oligonucleotides Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/and+forward+oligonucleotides+reverse+sgrna/10__1016_slash_j__isci__2026__116175-216-32-43 Average 86 stars, based on 1 article reviews
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Eurofins
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a Gagcggagtccgatgtctc Forward Primer Eurofins Na Mm Ccl27a, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/actctctgc+caaactgctgctcaagctgc+eurofins+human+na+primer+tgggcaagtc+thra/pm42229582-687-181-183 Average 86 stars, based on 1 article reviews
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5 Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/genotyping+primers+standard/pmc13122704-28-0-13 Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-50-0-5 Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer chatcre mutant forward caa aag cgc tct gaa gtt cct Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/genotyping+primers+standard/pmc13122704-27-0-12 Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-53-0-5 Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |