Review





Similar Products

86
Servicebio Inc u6 forward pcr primer
U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/primer+snrna+u6/pmc13145395-12-3-8
Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins htrac hdr genomic forward primer targeting lha
Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/and+forward+oligonucleotides+reverse+sgrna/pmc13265900-94-0-10
Average 86 stars, based on 1 article reviews
htrac hdr genomic forward primer targeting lha - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Bioneer Corporation pelb forward primer
Pelb Forward Primer, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/primer+sequences/pm42321788-80-16-10
Average 86 stars, based on 1 article reviews
pelb forward primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha
Gse310442 Oligonucleotides Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/and+forward+oligonucleotides+reverse+sgrna/10__1016_slash_j__isci__2026__116175-216-32-43
Average 86 stars, based on 1 article reviews
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins gagcggagtccgatgtctc forward primer eurofins na mm ccl27a
Gagcggagtccgatgtctc Forward Primer Eurofins Na Mm Ccl27a, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/actctctgc+caaactgctgctcaagctgc+eurofins+human+na+primer+tgggcaagtc+thra/pm42229582-687-181-183
Average 86 stars, based on 1 article reviews
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre wildtype forward gca aag aga cct cat ctg tgg a
Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/genotyping+primers+standard/pmc13122704-28-0-13
Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-50-0-5
Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre mutant forward caa aag cgc tct gaa gtt cct
Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/genotyping+primers+standard/pmc13122704-27-0-12
Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-53-0-5
Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results